β-Catenin promotes epithelial architecture by forming cell surface complexes with E-cadherin and also interacts with TCF/LEF-1 in the nucleus to control gene expression. reporter assays showed that full-length β-catenin is able to induce LEF-1-dependent FH535 transactivation whereas Arm β-catenin totally abolishes the transactivating function. However Arm β-catenin comprising deletions of known LEF-1-transactivating domains has the same apoptotic effects as full-length β-catenin. Overexpressed β-catenin also induces apoptosis in cells transfected with nuclear localization signal-deleted LEF-1 that localizes only in the cytoplasm. FH535 Therefore the apoptotic effects of overexpressed exogenous β-catenin do not rely on its transactivating function with nuclear LEF-1. Overexpressed δ-catenin comprising 10 Arm repeats induces only minor apoptosis suggesting that the major apoptotic effect may be due to domains specific to β-catenin as well as to Arm repeats. The absence of p53 Rb cyclin D1 or E2F1 does not impact the apoptotic effect of overexpressed β-catenin but Bcl-x(L) reduces it. We hypothesize that in FH535 vivo apoptosis of cells overexpressing β-catenin might be a physiological mechanism to remove them from the population. INTRODUCTION β-Catenin was first identified as a protein binding to E-cadherin in adherent junctions that are required to maintain the architecture of epithelia. β-Catenin can be released from cadherin complexes through several mechanisms including down-regulation of E-cadherin and the level of β-catenin in cells is definitely tightly controlled through relationships with other proteins such as APC GSK-3β β-TrCP and Axin (Aberle retinal neurons (Ahmed for 5 min. Supernatants were stored at ?80°C until protein assays were performed. The titers of the primary antibodies were CD86 identified (for β-catenin 1 dilution; for GFP 1 dilution). For β-catenin and BFP/GFP 20 μg of protein draw out was electrophoresed on 7.5% Tris-glycine gels and blotted onto nitrocellulose. We stained the blot membrane with 0.001% India ink (vol/vol) in PBS to confirm the equal loading of samples after developing blots with the use of ECL detection kits (Amersham Cleveland OH). Quantitation of Apoptotic Cells For the TUNEL test we used the in situ cell death detection kit from Boehringer Mannheim (Indianapolis IN). Briefly cells were transfected with plasmid comprising a specific gene as explained above. After culturing cells for different durations (2 4 and 7 d) they were fixed with 4% paraformaldehyde for 15 min rinsed with PBS and incubated in permeabilization remedy (0.1% Triton X-100 0.1% sodium citrate) for 2 min at 4°C. Cells were rinsed with PBS twice and 50 μl of TUNEL reaction mixture was added to the cells. After incubation for 1 h at 37°C in the dark cells were rinsed with PBS three times and analyzed under a LSM 410 confocal laser scanning microscope (LSM 410 confocal laser FH535 scanning microscope. For FH535 the DNA fragmentation assay cells at different times after transfection (2 and 5 d) were harvested and lysed in FH535 500 μl of lysis buffer (10 mM Tris-HCl pH 7.4 10 mM EDTA 0.1% SDS 0.1 mg/ml proteinase K) at 50°C for 16 h followed by an additional incubation with 50 μg/ml RNase A for 1 h. DNA was extracted with phenol/chloroform precipitated with ethanol and dissolved in 40 μl of TE buffer (10 mM Tris-HCl pH 7.4 1 mM EDTA). Four micrograms of extracted DNA was electrophoresed inside a 1.8% agarose gel visualized with ethidium staining and photographed under a UV transilluminator. Reverse Transcription PCR RNAs were extracted from NIH 3T3 fibroblasts and LEF-1-overexpressing stable cell lines with the use of a RNeasy mini kit (Qiagen Santa Clarita CA). Reverse transcription (RT)-PCR was performed with the use of amplimer units. Sequences of primers specific for lef-1 and c-myc were as follows: for lef-1 5 and 5′CGTGTTGAGGCTTCACGTGC3′; for c-myc 5 and 5′CGGTGGAGAA-GTTGCCACC3′. To confirm the even loading we used β-actin control primer units ((1999) showed the transactivation function of β-catenin depends on the level of LEF-1 we found that the apoptotic effects of β-catenin are not dependent on nuclear localization of exogenous LEF-1 nor do they differ among.